Thy1 promoter sequence
WebbThy1 promoter Alt name Thy-1.2 Species M. musculus (mouse) Insert Size (bp) 6500 GenBank ID Entrez Gene Thy1 ( a.k.a. CD90, T25, Thy-1, Thy-1.2, Thy1.1, Thy1.2) Cloning … Webb6 mars 2024 · In the Thy1 CreERT2 mice, in addition to microglia, C1q staining was present in cells that were YFP negative and that morphologically resembled interneurons (Fig. 2c) and colocalized with GAD67, an intracellular interneuron-specific marker …
Thy1 promoter sequence
Did you know?
Webb11 apr. 2002 · The regulatory elements of the murine Thy1.2 gene were used to drive Cre recombinase expression in the nervous system (NS) of transgenic mice. Eleven Thy1 … WebbA biweekly scientific journal publishing high-quality research in molecular biology and genetics, cancer biology, biochemistry, and related fields
Webb17 jan. 2015 · 5xFAD mice express human APP and PSEN1 transgenes with a total of five AD-linked mutations: the Swedish (K670N/M671L), Florida (I716V), and London (V717I) … WebbThy1.1-GFP Alt name CD90.1 Insert Size (bp) 1272 Promoter CMV Cloning Information Cloning method Restriction Enzyme 5′ cloning site EcoRI (not destroyed) 3′ cloning site BamHI (not destroyed) 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG 3′ sequencing primer aaaatttaacgcgaattttaacaaa (Common Sequencing Primers) Terms and Licenses
Webbför 2 dagar sedan · A genome-wide association study revealed that a common inherited polymorphism in the TCL1A promoter was associated ... whole-genome sequencing ... CD34 + CD38 −/lo THY1 +. This left ... Webb6 apr. 2024 · THY1 (or CD90) is a 25–37 kDa cell surface glycoprotein that is anchored to the plasma membrane by the glycosylphosphatidylinositol (GPI) motif at the C-terminus; it lacks both the transmembrane and cytoplasmic domains and well-defined ligands [ 6 ].
WebbThe Thy1 promoter targeted to the Rosa26 locus appeared active in virtually all Purkinje cells in the cerebellum and hippocampus. However, mosaic expression of the transgene …
Webb8 jan. 2024 · 79 the promoter, we inserted a first ... Selection of an appropriate linker sequence is important and depends on the goal of the made available under aCC-BY 4.0 … elkay white farmers sinkWebb7 aug. 2024 · We found ten commonly enriched genes in skeletal muscle perimysial and cardiac valve interstitial cells, including Thbs1, Comp, and Fmod (fibromodulin) (Fig. 4e, f, Supplementary Table 2 ),... elkay white quartz sinkWebbWe have exploited the structural homology, but different patterns of expression of the murine and human Thy-1 genes to map a number of tissue-specific enhancer elements … elkay with flexi guardWebb7 jan. 2024 · Contains 6.5 kb of the murine thy1.2 gene, extending from the promoter to the intron following exon 4, but lacking exon 3 and its flanking introns (see Figure 1 in Caroni … elkay white apron sinksWebbThy1 expression was examined using in situ hybridization [2]. The predicted amino acid sequence indicates that the mouse Thy-1 molecule contains a 19 amino acid leader … elkay weldbilt scullery sinkWebb28 sep. 2016 · In summary, these results demonstrate that mutant PFN1 driven by the Thy1.2 promoter is expressed in the largest α motor neuron population, whereas the transgene expression is broader in Prp-PFN1 C71G and PrP-PFN1 WT mice, including both motor and nonmotor neurons. Fig. S1. elkay watersentry vii replacement filterWebbSeveral groups generated Tg mice that overexpress APP with or without FAD mutations using various promoters (Table 1 ), such as platelet-derived growth factor-β (PDGF-β), prion protein (PrP), and Thy1. forchange xiamen inc